Genetics has proven to be a powerful approach to study neurodegenerative diseases, resulting in the identification of various causal and risk variants. Previously, we introduced NeuroX Illumina genotyping arrays, fast and efficient genotyping platform was designed to study genetic variation in neurodegenerative diseases. Here, we present its updated version, called neurochip.
The neurochip is cheap, specially designed array containing backbone marking variant of about 306 670 variants are equipped with custom content manually curated consists of 179 467 variants involved in neurological diseases as diverse, including Alzheimer’s disease, Parkinson’s disease, Lewy body dementia, amyotrophic lateral sclerosis, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, and multiple system atrophy.
The backbone of tagging selected for its low cost and resolution genome-wide good; custom content can be combined with other backbones, such as population or array of drug development. Using neurochip, we can accurately identify rare variants and blame over 5.3 million common SNPs from the latest release of the Consortium References haplotype. In summary, we describe the design and use of arrays neurochip and demonstrate the ability to detect rare variants of pathogens in a variety of neurodegenerative diseases. Neurochip contains a more comprehensive and improved, which makes it a reliable, high-throughput, cost-effective screening tool for genetic research and molecular diagnostics in neurodegenerative diseases.
DGKA Antibody |
33723-100ul |
SAB |
100ul |
EUR 252.00 |
DGKA Antibody |
33723-50ul |
SAB |
50ul |
EUR 187.00 |
DGKA antibody |
10R-3825 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-3826 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-3827 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-3828 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-3830 |
Fitzgerald |
100 ul |
EUR 691.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-6888 |
Fitzgerald |
100 ul |
EUR 726.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-8135 |
Fitzgerald |
100 ug |
EUR 457.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-8139 |
Fitzgerald |
100 ug |
EUR 457.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA antibody |
10R-8140 |
Fitzgerald |
100 ug |
EUR 457.00 |
Description: Mouse monoclonal DGKA antibody |
DGKA Antibody |
1-CSB-PA002124 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
DGKA Antibody |
CSB-PA974220- |
Cusabio |
|
EUR 335.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
DGKA Antibody |
CSB-PA974220-100ul |
Cusabio |
100ul |
EUR 316.00 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
DGKA Antibody |
DF3127 |
Affbiotech |
200ul |
EUR 304.00 |
Description: DGKA Antibody detects endogenous levels of total DGKA. |
DGKA Antibody |
1-CSB-PA006832ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
DGKA Antibody |
1-CSB-PA006832GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DGKA antibody |
70R-5806 |
Fitzgerald |
50 ug |
EUR 467.00 |
Description: Rabbit polyclonal DGKA antibody raised against the N terminal of DGKA |
DGKA Conjugated Antibody |
C33723 |
SAB |
100ul |
EUR 397.00 |
anti- DGKA antibody |
FNab02356 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: diacylglycerol kinase, alpha 80kDa
- Uniprot ID: P23743
- Gene ID: 1606
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against DGKA |
Anti-DGKA antibody |
STJ28976 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene. |
Anti-DGKA antibody |
STJ115904 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene. |
Anti-DGKA antibody |
STJ23372 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene. |
DGKA siRNA |
20-abx901480 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DGKA siRNA |
20-abx914060 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DGKA siRNA |
20-abx914061 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DGKA |
YF-PA11276 |
Abfrontier |
50 ug |
EUR 363.00 |
Description: Mouse polyclonal to DGKA |
anti-DGKA |
YF-PA11277 |
Abfrontier |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal to DGKA |
anti-DGKA |
YF-PA27205 |
Abfrontier |
100 ul |
EUR 403.00 |
Description: Rabbit polyclonal to DGKA |
DGKA Rabbit pAb |
A13969-100ul |
Abclonal |
100 ul |
EUR 308.00 |
DGKA Rabbit pAb |
A13969-200ul |
Abclonal |
200 ul |
EUR 459.00 |
DGKA Rabbit pAb |
A13969-20ul |
Abclonal |
20 ul |
EUR 183.00 |
DGKA Rabbit pAb |
A13969-50ul |
Abclonal |
50 ul |
EUR 223.00 |
DGKA Blocking Peptide |
33R-2431 |
Fitzgerald |
100 ug |
EUR 180.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DGKA antibody, catalog no. 70R-5806 |
DGKA Blocking Peptide |
DF3127-BP |
Affbiotech |
1mg |
EUR 195.00 |
DGKA cloning plasmid |
CSB-CL006832HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2208
- Sequence: atggccaaggagaggggcctaataagccccagtgattttgcccagctgcaaaaatacatggaatactccaccaaaaaggtcagtgatgtcctaaagctcttcgaggatggcgagatggctaaatatgtccaaggagatgccattgggtacgagggattccagcaattcctgaaaa
- Show more
|
Description: A cloning plasmid for the DGKA gene. |
DGKA Rabbit pAb |
A3824-100ul |
Abclonal |
100 ul |
EUR 308.00 |
DGKA Rabbit pAb |
A3824-200ul |
Abclonal |
200 ul |
EUR 459.00 |
DGKA Rabbit pAb |
A3824-20ul |
Abclonal |
20 ul |
Ask for price |
DGKA Rabbit pAb |
A3824-50ul |
Abclonal |
50 ul |
Ask for price |
DGKA Rabbit pAb |
A6896-100ul |
Abclonal |
100 ul |
EUR 308.00 |
DGKA Rabbit pAb |
A6896-200ul |
Abclonal |
200 ul |
EUR 459.00 |
DGKA Rabbit pAb |
A6896-20ul |
Abclonal |
20 ul |
EUR 183.00 |
DGKA Rabbit pAb |
A6896-50ul |
Abclonal |
50 ul |
EUR 223.00 |
Anti-DGKA (2B7) |
YF-MA10227 |
Abfrontier |
100 ug |
EUR 363.00 |
Description: Mouse monoclonal to DGKA |
Diacylglycerol Kinase Alpha (DGKA) Antibody |
20-abx006850 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
20-abx002774 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKa) Antibody |
20-abx102733 |
Abbexa |
- EUR 439.00
- EUR 133.00
- EUR 1233.00
- EUR 592.00
- EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
20-abx112054 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
abx036735-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKa) Antibody |
20-abx130035 |
Abbexa |
- EUR 453.00
- EUR 133.00
- EUR 1302.00
- EUR 620.00
- EUR 342.00
|
|
- Shipped within 5-7 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
20-abx013437 |
Abbexa |
- EUR 314.00
- EUR 98.00
- EUR 398.00
- EUR 495.00
|
|
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
abx033889-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
abx033889-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
Polyclonal DGKA Antibody (C-term) |
APR15728G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DGKA (C-term). This antibody is tested and proven to work in the following applications: |
Diacylglycerol Kinase Alpha (DGKA) Antibody |
abx330931-100ul |
Abbexa |
100 ul |
EUR 425.00 |
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
20-abx324527 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
20-abx321813 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diacylglycerol Kinase Alpha (DGKA) Antibody |
abx232356-100ug |
Abbexa |
100 ug |
EUR 481.00 |
- Shipped within 5-12 working days.
|
Rat DGKA shRNA Plasmid |
20-abx987533 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DGKA shRNA Plasmid |
20-abx969942 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DGKA shRNA Plasmid |
20-abx951129 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DGKA Recombinant Protein (Human) |
RP009211 |
ABM |
100 ug |
Ask for price |
DGKA Recombinant Protein (Rat) |
RP197942 |
ABM |
100 ug |
Ask for price |
DGKA Recombinant Protein (Mouse) |
RP128864 |
ABM |
100 ug |
Ask for price |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse) |
4-PAC435Mu01 |
Cloud-Clone |
- EUR 251.00
- EUR 2576.00
- EUR 640.00
- EUR 316.00
- EUR 215.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa) |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat) |
4-PAC435Ra01 |
Cloud-Clone |
- EUR 259.00
- EUR 2708.00
- EUR 670.00
- EUR 328.00
- EUR 219.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa) |
Human Diacylglycerol kinase alpha (DGKA) |
1-CSB-EP006832HU |
Cusabio |
- EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
|
|
- MW: 86.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Diacylglycerol kinase alpha(DGKA) expressed in E.coli |
DGKA Colorimetric Cell-Based ELISA |
EKC1694 |
BosterBio |
100ul |
EUR 572.00 |
Human Diacylglycerol kinase alpha (DGKA) |
1-CSB-BP006832HU |
Cusabio |
- EUR 840.00
- EUR 332.00
- EUR 2170.00
- EUR 1135.00
- EUR 1579.00
- EUR 470.00
|
|
- MW: 86.7 kDa
- Buffer composition: Tris-based buffer, 50% glycerol
|
Description: Recombinant Human Diacylglycerol kinase alpha(DGKA) expressed in Baculovirus |
Dgka ORF Vector (Rat) (pORF) |
ORF065982 |
ABM |
1.0 ug DNA |
EUR 506.00 |
DGKA ORF Vector (Human) (pORF) |
ORF003071 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Dgka ORF Vector (Mouse) (pORF) |
ORF042956 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Recombinant Diacylglycerol Kinase Alpha (DGKa) |
4-RPC435Mu01 |
Cloud-Clone |
- EUR 467.36
- EUR 228.00
- EUR 1477.60
- EUR 559.20
- EUR 1018.40
- EUR 376.00
- EUR 3544.00
|
|
- Uniprot ID: O88673
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.0kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Mouse Diacylglycerol Kinase Alpha expressed in: E.coli |
Recombinant Diacylglycerol Kinase Alpha (DGKa) |
4-RPC435Ra01 |
Cloud-Clone |
- EUR 508.58
- EUR 239.00
- EUR 1632.16
- EUR 610.72
- EUR 1121.44
- EUR 403.00
- EUR 3930.40
|
|
- Uniprot ID: P51556
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.7kDa
- Isoelectric Point: 8.6
|
Description: Recombinant Rat Diacylglycerol Kinase Alpha expressed in: E.coli |
DGKA ELISA Kit (Mouse) (OKEH04965) |
OKEH04965 |
Aviva Systems Biology |
96 Wells |
EUR 779.00 |
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL |
DGKA ELISA Kit (Human) (OKEH04966) |
OKEH04966 |
Aviva Systems Biology |
96 Wells |
EUR 779.00 |
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.315 ng/mL |
DGKA ELISA Kit (Rat) (OKEH03740) |
OKEH03740 |
Aviva Systems Biology |
96 Wells |
EUR 779.00 |
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.317 ng/mL |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), APC |
4-PAC435Mu01-APC |
Cloud-Clone |
- EUR 351.00
- EUR 3365.00
- EUR 935.00
- EUR 449.00
- EUR 222.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC435Mu01-Biotin |
Cloud-Clone |
- EUR 316.00
- EUR 2526.00
- EUR 744.00
- EUR 387.00
- EUR 221.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Biotin. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), Cy3 |
4-PAC435Mu01-Cy3 |
Cloud-Clone |
- EUR 427.00
- EUR 4445.00
- EUR 1205.00
- EUR 557.00
- EUR 254.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Cy3. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), FITC |
4-PAC435Mu01-FITC |
Cloud-Clone |
- EUR 301.00
- EUR 2712.00
- EUR 768.00
- EUR 379.00
- EUR 197.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with FITC. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), HRP |
4-PAC435Mu01-HRP |
Cloud-Clone |
- EUR 321.00
- EUR 2933.00
- EUR 827.00
- EUR 405.00
- EUR 209.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with HRP. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), PE |
4-PAC435Mu01-PE |
Cloud-Clone |
- EUR 301.00
- EUR 2712.00
- EUR 768.00
- EUR 379.00
- EUR 197.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with PE. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), APC |
4-PAC435Ra01-APC |
Cloud-Clone |
- EUR 364.00
- EUR 3545.00
- EUR 980.00
- EUR 467.00
- EUR 227.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), Biotinylated |
4-PAC435Ra01-Biotin |
Cloud-Clone |
- EUR 325.00
- EUR 2658.00
- EUR 777.00
- EUR 400.00
- EUR 225.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Biotin. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), Cy3 |
4-PAC435Ra01-Cy3 |
Cloud-Clone |
- EUR 444.00
- EUR 4685.00
- EUR 1265.00
- EUR 581.00
- EUR 261.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Cy3. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), FITC |
4-PAC435Ra01-FITC |
Cloud-Clone |
- EUR 311.00
- EUR 2856.00
- EUR 804.00
- EUR 393.00
- EUR 202.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with FITC. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), HRP |
4-PAC435Ra01-HRP |
Cloud-Clone |
- EUR 332.00
- EUR 3089.00
- EUR 866.00
- EUR 421.00
- EUR 213.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with HRP. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), PE |
4-PAC435Ra01-PE |
Cloud-Clone |
- EUR 311.00
- EUR 2856.00
- EUR 804.00
- EUR 393.00
- EUR 202.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with PE. |
Rat Diacylglycerol Kinase Alpha (DGKa) Protein |
20-abx167660 |
Abbexa |
- EUR 704.00
- EUR 286.00
- EUR 2193.00
- EUR 843.00
- EUR 509.00
|
|
- Shipped within 5-7 working days.
|
Mouse Diacylglycerol Kinase Alpha (DGKa) Protein |
20-abx066314 |
Abbexa |
- EUR 648.00
- EUR 272.00
- EUR 1998.00
- EUR 773.00
- EUR 467.00
|
|
- Shipped within 5-7 working days.
|
DGKA sgRNA CRISPR Lentivector set (Human) |
K0596301 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Dgka sgRNA CRISPR Lentivector set (Rat) |
K6955301 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Dgka sgRNA CRISPR Lentivector set (Mouse) |
K4621601 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC435Mu01-APC-Cy7 |
Cloud-Clone |
- EUR 583.00
- EUR 6610.00
- EUR 1750.00
- EUR 778.00
- EUR 324.00
|
|
- Sequence of the immunogen: DGKa (His305~Arg531)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC-Cy7. |
Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC435Ra01-APC-Cy7 |
Cloud-Clone |
- EUR 608.00
- EUR 6970.00
- EUR 1840.00
- EUR 814.00
- EUR 335.00
|
|
- Sequence of the immunogen: DGKa (Ala312~Glu557)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC-Cy7. |
Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E02D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E02D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E02D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Dgka/ Diacylglycerol kinase alpha ELISA Kit |
E0395Mo |
Sunlong |
1 Kit |
EUR 632.00 |
Human Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E01D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E01D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E01D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dgka/ Diacylglycerol kinase alpha ELISA Kit |
E0292Ra |
Sunlong |
1 Kit |
EUR 646.00 |
Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E03D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E03D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E03D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E06D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E06D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E06D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DGKA/ Diacylglycerol kinase alpha ELISA Kit |
E0687Hu |
Sunlong |
1 Kit |
EUR 605.00 |
Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E04D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E04D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E04D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Diacylglycerol Kinase Alpha (DGKA) ELISA Kit |
abx256685-96tests |
Abbexa |
96 tests |
EUR 739.00 |
- Shipped within 5-12 working days.
|
Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E09D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E09D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E09D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E08D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E08D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E08D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E07D0283-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E07D0283-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit |
E07D0283-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Diacylglycerol kinase alpha, DGKA ELISA KIT |
ELI-07742h |
Lifescience Market |
96 Tests |
EUR 824.00 |
Mouse Diacylglycerol kinase alpha, Dgka ELISA KIT |
ELI-07743m |
Lifescience Market |
96 Tests |
EUR 865.00 |
Porcine Diacylglycerol kinase alpha, DGKA ELISA KIT |
ELI-07744p |
Lifescience Market |
96 Tests |
EUR 928.00 |
Bovine Diacylglycerol kinase alpha, DGKA ELISA KIT |
ELI-07746b |
Lifescience Market |
96 Tests |
EUR 928.00 |
Cow Diacylglycerol Kinase Alpha (DGKA) ELISA Kit |
abx521265-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Human Diacylglycerol Kinase Alpha (DGKA) ELISA Kit |
abx521266-96tests |
Abbexa |
96 tests |
EUR 739.00 |
- Shipped within 5-12 working days.
|
Mouse Diacylglycerol Kinase Alpha (DGKA) ELISA Kit |
abx521267-96tests |
Abbexa |
96 tests |
EUR 739.00 |
- Shipped within 5-12 working days.
|
Pig Diacylglycerol Kinase Alpha (DGKA) ELISA Kit |
abx521268-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Human Diacylglycerol Kinase Alpha (DGKA) ELISA Kit |
abx595725-96tests |
Abbexa |
96 tests |
EUR 637.00 |
- Shipped within 1-2 weeks.
|
Rat Dgka(Diacylglycerol kinase alpha) ELISA Kit |
ER0710 |
FN Test |
96T |
EUR 524.10 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: P51556
- Alias: Dgka/DAGK1/DAG kinase alpha/DAGK/DAGK1diacylglycerol kinase, alpha(80kD)/DGK-alphaEC 2.7.1.107/diacylglycerol kinase alpha/diacylglycerol kinase, alpha 80kDa/Diglyceride kinase alpha/MGC12821,
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml |
DGKA sgRNA CRISPR Lentivector (Human) (Target 1) |
K0596302 |
ABM |
1.0 ug DNA |
EUR 154.00 |
DGKA sgRNA CRISPR Lentivector (Human) (Target 2) |
K0596303 |
ABM |
1.0 ug DNA |
EUR 154.00 |
DGKA sgRNA CRISPR Lentivector (Human) (Target 3) |
K0596304 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Dgka sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6955302 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Dgka sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6955303 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Dgka sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6955304 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Dgka sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4621602 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Dgka sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4621603 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Dgka sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4621604 |
ABM |
1.0 ug DNA |
EUR 154.00 |
DGKA Protein Vector (Mouse) (pPB-C-His) |
PV171822 |
ABM |
500 ng |
EUR 1065.00 |
DGKA Protein Vector (Mouse) (pPB-N-His) |
PV171823 |
ABM |
500 ng |
EUR 1065.00 |