NeuroChip, an updated version of the NeuroX genotyping platform to rapidly screen for variants associated with neurological diseases.

Genetics has proven to be a powerful approach to study neurodegenerative diseases, resulting in the identification of various causal and risk variants. Previously, we introduced NeuroX Illumina genotyping arrays, fast and efficient genotyping platform was designed to study genetic variation in neurodegenerative diseases. Here, we present its updated version, called neurochip.

The neurochip is cheap, specially designed array containing backbone marking variant of about 306 670 variants are equipped with custom content manually curated consists of 179 467 variants involved in neurological diseases as diverse, including Alzheimer’s disease, Parkinson’s disease, Lewy body dementia, amyotrophic lateral sclerosis, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, and multiple system atrophy.

The backbone of tagging selected for its low cost and resolution genome-wide good; custom content can be combined with other backbones, such as population or array of drug development. Using neurochip, we can accurately identify rare variants and blame over 5.3 million common SNPs from the latest release of the Consortium References haplotype. In summary, we describe the design and use of arrays neurochip and demonstrate the ability to detect rare variants of pathogens in a variety of neurodegenerative diseases. Neurochip contains a more comprehensive and improved, which makes it a reliable, high-throughput, cost-effective screening tool for genetic research and molecular diagnostics in neurodegenerative diseases.

DGKA Antibody
33723-100ul	SAB	100ul	EUR 252

DGKA Antibody
33723-50ul	SAB	50ul	EUR 187

DGKA antibody
10R-3825	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-3826	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-3827	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-3828	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-3830	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-6888	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-8135	Fitzgerald	100 ug	EUR 457
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-8139	Fitzgerald	100 ug	EUR 457
Description: Mouse monoclonal DGKA antibody

DGKA antibody
10R-8140	Fitzgerald	100 ug	EUR 457
Description: Mouse monoclonal DGKA antibody

DGKA Antibody
1-CSB-PA002124	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

DGKA Antibody
CSB-PA974220-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

DGKA Antibody
CSB-PA974220-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

DGKA Antibody
DF3127	Affbiotech	200ul	EUR 304
Description: DGKA Antibody detects endogenous levels of total DGKA.

DGKA Antibody
1-CSB-PA006832ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DGKA Antibody
1-CSB-PA006832GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DGKA antibody
70R-5806	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DGKA antibody raised against the N terminal of DGKA

DGKA Antibody
ABD3127	Lifescience Market	100 ug	EUR 438

DGKA Conjugated Antibody
C33723	SAB	100ul	EUR 397

anti- DGKA antibody
FNab02356	FN Test	100µg	EUR 505.25
Immunogen: diacylglycerol kinase, alpha 80kDa Uniprot ID: P23743 Gene ID: 1606 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DGKA

Anti-DGKA antibody
PAab02356	Lifescience Market	100 ug	EUR 355

Anti-DGKA antibody
STJ28976	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Anti-DGKA antibody
STJ115904	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Anti-DGKA antibody
STJ23372	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Dgka/ Rat Dgka ELISA Kit
ELI-07745r	Lifescience Market	96 Tests	EUR 886

DGKA siRNA
20-abx901480	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DGKA siRNA
20-abx914060	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DGKA siRNA
20-abx914061	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DGKA
YF-PA11276	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DGKA

anti-DGKA
YF-PA11277	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DGKA

anti-DGKA
YF-PA27205	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to DGKA

DGKA Rabbit pAb
A13969-100ul	Abclonal	100 ul	EUR 308

DGKA Rabbit pAb
A13969-200ul	Abclonal	200 ul	EUR 459

DGKA Rabbit pAb
A13969-20ul	Abclonal	20 ul	EUR 183

DGKA Rabbit pAb
A13969-50ul	Abclonal	50 ul	EUR 223

DGKA Blocking Peptide
33R-2431	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DGKA antibody, catalog no. 70R-5806

DGKA Blocking Peptide
DF3127-BP	Affbiotech	1mg	EUR 195

DGKA cloning plasmid
CSB-CL006832HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2208 Sequence: atggccaaggagaggggcctaataagccccagtgattttgcccagctgcaaaaatacatggaatactccaccaaaaaggtcagtgatgtcctaaagctcttcgaggatggcgagatggctaaatatgtccaaggagatgccattgggtacgagggattccagcaattcctgaaaa Show more
Description: A cloning plasmid for the DGKA gene.

DGKA Rabbit pAb
A3824-100ul	Abclonal	100 ul	EUR 308

DGKA Rabbit pAb
A3824-200ul	Abclonal	200 ul	EUR 459

DGKA Rabbit pAb
A3824-20ul	Abclonal	20 ul	Ask for price

DGKA Rabbit pAb
A3824-50ul	Abclonal	50 ul	Ask for price

DGKA Rabbit pAb
A6896-100ul	Abclonal	100 ul	EUR 308

DGKA Rabbit pAb
A6896-200ul	Abclonal	200 ul	EUR 459

DGKA Rabbit pAb
A6896-20ul	Abclonal	20 ul	EUR 183

DGKA Rabbit pAb
A6896-50ul	Abclonal	50 ul	EUR 223

Anti-DGKA (2B7)
YF-MA10227	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DGKA

Diacylglycerol Kinase Alpha (DGKA) Antibody
20-abx006850	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
20-abx002774	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKa) Antibody
20-abx102733	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
20-abx112054	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
abx036735-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKa) Antibody
20-abx130035	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
20-abx013437	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
abx033889-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
abx033889-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polyclonal DGKA Antibody (C-term)
APR15728G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DGKA (C-term). This antibody is tested and proven to work in the following applications:

Diacylglycerol Kinase Alpha (DGKA) Antibody
abx330931-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
20-abx324527	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
20-abx321813	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody
abx232356-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

DGKA ELISA KIT|Human
EF004859	Lifescience Market	96 Tests	EUR 689

Rat DGKA shRNA Plasmid
20-abx987533	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DGKA shRNA Plasmid
20-abx969942	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DGKA shRNA Plasmid
20-abx951129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DGKA Recombinant Protein (Human)
RP009211	ABM	100 ug	Ask for price

DGKA Recombinant Protein (Rat)
RP197942	ABM	100 ug	Ask for price

DGKA Recombinant Protein (Mouse)
RP128864	ABM	100 ug	Ask for price

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse)
4-PAC435Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa)

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat)
4-PAC435Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa)

Human Diacylglycerol kinase alpha (DGKA)
1-CSB-EP006832HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 86.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Diacylglycerol kinase alpha(DGKA) expressed in E.coli

DGKA Colorimetric Cell-Based ELISA
EKC1694	BosterBio	100ul	EUR 572

Human Diacylglycerol kinase alpha (DGKA)
1-CSB-BP006832HU	Cusabio	EUR 840.00 EUR 332.00 EUR 2170.00 EUR 1135.00 EUR 1579.00 EUR 470.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 86.7 kDa Buffer composition: Tris-based buffer, 50% glycerol
Description: Recombinant Human Diacylglycerol kinase alpha(DGKA) expressed in Baculovirus

Dgka ORF Vector (Rat) (pORF)
ORF065982	ABM	1.0 ug DNA	EUR 506

DGKA ORF Vector (Human) (pORF)
ORF003071	ABM	1.0 ug DNA	EUR 95

Dgka ORF Vector (Mouse) (pORF)
ORF042956	ABM	1.0 ug DNA	EUR 506

Recombinant Diacylglycerol Kinase Alpha (DGKa)
4-RPC435Mu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O88673 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.0kDa Isoelectric Point: 6.3
Description: Recombinant Mouse Diacylglycerol Kinase Alpha expressed in: E.coli

Recombinant Diacylglycerol Kinase Alpha (DGKa)
4-RPC435Ra01	Cloud-Clone	EUR 508.58 EUR 239.00 EUR 1632.16 EUR 610.72 EUR 1121.44 EUR 403.00 EUR 3930.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51556 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.7kDa Isoelectric Point: 8.6
Description: Recombinant Rat Diacylglycerol Kinase Alpha expressed in: E.coli

DGKA ELISA Kit (Mouse) (OKEH04965)
OKEH04965	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL

DGKA ELISA Kit (Human) (OKEH04966)
OKEH04966	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.315 ng/mL

DGKA ELISA Kit (Rat) (OKEH03740)
OKEH03740	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.317 ng/mL

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), APC
4-PAC435Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), Biotinylated
4-PAC435Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Biotin.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), Cy3
4-PAC435Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Cy3.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), FITC
4-PAC435Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with FITC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), HRP
4-PAC435Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with HRP.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), PE
4-PAC435Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with PE.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), APC
4-PAC435Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), Biotinylated
4-PAC435Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Biotin.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), Cy3
4-PAC435Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Cy3.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), FITC
4-PAC435Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with FITC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), HRP
4-PAC435Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with HRP.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), PE
4-PAC435Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with PE.

Rat Diacylglycerol Kinase Alpha (DGKa) Protein
20-abx167660	Abbexa	EUR 704.00 EUR 286.00 EUR 2193.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Diacylglycerol Kinase Alpha (DGKa) Protein
20-abx066314	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

DGKA sgRNA CRISPR Lentivector set (Human)
K0596301	ABM	3 x 1.0 ug	EUR 339

Dgka sgRNA CRISPR Lentivector set (Rat)
K6955301	ABM	3 x 1.0 ug	EUR 339

Dgka sgRNA CRISPR Lentivector set (Mouse)
K4621601	ABM	3 x 1.0 ug	EUR 339

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC435Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (His305~Arg531) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC-Cy7.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), APC-Cy7
4-PAC435Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DGKa (Ala312~Glu557) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC-Cy7.

Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit
E02D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit
E02D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit
E02D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dgka/ Diacylglycerol kinase alpha ELISA Kit
E0395Mo	Sunlong	1 Kit	EUR 632

Human Diacylglycerol kinase Alpha (DGKA) ELISA kit
E01D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diacylglycerol kinase Alpha (DGKA) ELISA kit
E01D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diacylglycerol kinase Alpha (DGKA) ELISA kit
E01D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dgka/ Diacylglycerol kinase alpha ELISA Kit
E0292Ra	Sunlong	1 Kit	EUR 646

Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit
E03D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit
E03D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit
E03D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit
E06D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit
E06D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit
E06D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DGKA/ Diacylglycerol kinase alpha ELISA Kit
E0687Hu	Sunlong	1 Kit	EUR 605

Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit
E04D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit
E04D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit
E04D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Diacylglycerol Kinase Alpha (DGKA) ELISA Kit
abx256685-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit
E09D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit
E09D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit
E09D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit
E08D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit
E08D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit
E08D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit
E07D0283-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit
E07D0283-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit
E07D0283-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diacylglycerol kinase alpha, DGKA ELISA KIT
ELI-07742h	Lifescience Market	96 Tests	EUR 824

Mouse Diacylglycerol kinase alpha, Dgka ELISA KIT
ELI-07743m	Lifescience Market	96 Tests	EUR 865

Porcine Diacylglycerol kinase alpha, DGKA ELISA KIT
ELI-07744p	Lifescience Market	96 Tests	EUR 928

Bovine Diacylglycerol kinase alpha, DGKA ELISA KIT
ELI-07746b	Lifescience Market	96 Tests	EUR 928

Cow Diacylglycerol Kinase Alpha (DGKA) ELISA Kit
abx521265-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Diacylglycerol Kinase Alpha (DGKA) ELISA Kit
abx521266-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Diacylglycerol Kinase Alpha (DGKA) ELISA Kit
abx521267-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Pig Diacylglycerol Kinase Alpha (DGKA) ELISA Kit
abx521268-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Diacylglycerol Kinase Alpha (DGKA) ELISA Kit
abx595725-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Rat Dgka(Diacylglycerol kinase alpha) ELISA Kit
ER0710	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: P51556 Alias: Dgka/DAGK1/DAG kinase alpha/DAGK/DAGK1diacylglycerol kinase, alpha(80kD)/DGK-alphaEC 2.7.1.107/diacylglycerol kinase alpha/diacylglycerol kinase, alpha 80kDa/Diglyceride kinase alpha/MGC12821, Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

DGKA sgRNA CRISPR Lentivector (Human) (Target 1)
K0596302	ABM	1.0 ug DNA	EUR 154

DGKA sgRNA CRISPR Lentivector (Human) (Target 2)
K0596303	ABM	1.0 ug DNA	EUR 154

DGKA sgRNA CRISPR Lentivector (Human) (Target 3)
K0596304	ABM	1.0 ug DNA	EUR 154

Dgka sgRNA CRISPR Lentivector (Rat) (Target 1)
K6955302	ABM	1.0 ug DNA	EUR 154

Dgka sgRNA CRISPR Lentivector (Rat) (Target 2)
K6955303	ABM	1.0 ug DNA	EUR 154

Dgka sgRNA CRISPR Lentivector (Rat) (Target 3)
K6955304	ABM	1.0 ug DNA	EUR 154

Dgka sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4621602	ABM	1.0 ug DNA	EUR 154

Dgka sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4621603	ABM	1.0 ug DNA	EUR 154

Dgka sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4621604	ABM	1.0 ug DNA	EUR 154

DGKA Protein Vector (Mouse) (pPB-C-His)
PV171822	ABM	500 ng	EUR 1065

DGKA Protein Vector (Mouse) (pPB-N-His)
PV171823	ABM	500 ng	EUR 1065