NeuroChip, an updated version of the NeuroX genotyping platform to rapidly screen for variants associated with neurological diseases.

Genetics has proven to be a powerful approach to study neurodegenerative diseases, resulting in the identification of various causal and risk variants. Previously, we introduced NeuroX Illumina genotyping arrays, fast and efficient genotyping platform was designed to study genetic variation in neurodegenerative diseases. Here, we present its updated version, called neurochip.

The neurochip is cheap, specially designed array containing backbone marking variant of about 306 670 variants are equipped with custom content manually curated consists of 179 467 variants involved in neurological diseases as diverse, including Alzheimer’s disease, Parkinson’s disease, Lewy body dementia, amyotrophic lateral sclerosis, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, and multiple system atrophy.

The backbone of tagging selected for its low cost and resolution genome-wide good; custom content can be combined with other backbones, such as population or array of drug development. Using neurochip, we can accurately identify rare variants and blame over 5.3 million common SNPs from the latest release of the Consortium References haplotype. In summary, we describe the design and use of arrays neurochip and demonstrate the ability to detect rare variants of pathogens in a variety of neurodegenerative diseases. Neurochip contains a more comprehensive and improved, which makes it a reliable, high-throughput, cost-effective screening tool for genetic research and molecular diagnostics in neurodegenerative diseases.

DGKA Antibody

33723-100ul 100ul
EUR 252

DGKA Antibody

33723-50ul 50ul
EUR 187

DGKA antibody

10R-3825 100 ul
EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3826 100 ul
EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3827 100 ul
EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3828 100 ul
EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3830 100 ul
EUR 691
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-6888 100 ul
EUR 726
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-8135 100 ug
EUR 457
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-8139 100 ug
EUR 457
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-8140 100 ug
EUR 457
Description: Mouse monoclonal DGKA antibody

DGKA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

DGKA Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

DGKA Antibody

CSB-PA974220-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

DGKA Antibody

DF3127 200ul
EUR 304
Description: DGKA Antibody detects endogenous levels of total DGKA.

DGKA Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DGKA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DGKA antibody

70R-5806 50 ug
EUR 467
Description: Rabbit polyclonal DGKA antibody raised against the N terminal of DGKA

DGKA Antibody

ABD3127 100 ug
EUR 438

DGKA Conjugated Antibody

C33723 100ul
EUR 397

anti- DGKA antibody

FNab02356 100µg
EUR 505.25
  • Immunogen: diacylglycerol kinase, alpha 80kDa
  • Uniprot ID: P23743
  • Gene ID: 1606
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DGKA

Anti-DGKA antibody

PAab02356 100 ug
EUR 355

Anti-DGKA antibody

STJ28976 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Anti-DGKA antibody

STJ115904 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Anti-DGKA antibody

STJ23372 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Dgka/ Rat Dgka ELISA Kit

ELI-07745r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11276 50 ug
EUR 363
Description: Mouse polyclonal to DGKA


YF-PA11277 100 ug
EUR 403
Description: Rabbit polyclonal to DGKA


YF-PA27205 100 ul
EUR 403
Description: Rabbit polyclonal to DGKA

DGKA Rabbit pAb

A13969-100ul 100 ul
EUR 308

DGKA Rabbit pAb

A13969-200ul 200 ul
EUR 459

DGKA Rabbit pAb

A13969-20ul 20 ul
EUR 183

DGKA Rabbit pAb

A13969-50ul 50 ul
EUR 223

DGKA Blocking Peptide

33R-2431 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DGKA antibody, catalog no. 70R-5806

DGKA Blocking Peptide

DF3127-BP 1mg
EUR 195

DGKA cloning plasmid

CSB-CL006832HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2208
  • Sequence: atggccaaggagaggggcctaataagccccagtgattttgcccagctgcaaaaatacatggaatactccaccaaaaaggtcagtgatgtcctaaagctcttcgaggatggcgagatggctaaatatgtccaaggagatgccattgggtacgagggattccagcaattcctgaaaa
  • Show more
Description: A cloning plasmid for the DGKA gene.

DGKA Rabbit pAb

A3824-100ul 100 ul
EUR 308

DGKA Rabbit pAb

A3824-200ul 200 ul
EUR 459

DGKA Rabbit pAb

A3824-20ul 20 ul Ask for price

DGKA Rabbit pAb

A3824-50ul 50 ul Ask for price

DGKA Rabbit pAb

A6896-100ul 100 ul
EUR 308

DGKA Rabbit pAb

A6896-200ul 200 ul
EUR 459

DGKA Rabbit pAb

A6896-20ul 20 ul
EUR 183

DGKA Rabbit pAb

A6896-50ul 50 ul
EUR 223

Anti-DGKA (2B7)

YF-MA10227 100 ug
EUR 363
Description: Mouse monoclonal to DGKA

Diacylglycerol Kinase Alpha (DGKA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKa) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx036735-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKa) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx033889-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx033889-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal DGKA Antibody (C-term)

APR15728G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DGKA (C-term). This antibody is tested and proven to work in the following applications:

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx330931-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx232356-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.


EF004859 96 Tests
EUR 689

Rat DGKA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DGKA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DGKA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DGKA Recombinant Protein (Human)

RP009211 100 ug Ask for price

DGKA Recombinant Protein (Rat)

RP197942 100 ug Ask for price

DGKA Recombinant Protein (Mouse)

RP128864 100 ug Ask for price

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa)

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa)

Human Diacylglycerol kinase alpha (DGKA)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 86.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Diacylglycerol kinase alpha(DGKA) expressed in E.coli

DGKA Colorimetric Cell-Based ELISA

EKC1694 100ul
EUR 572

Human Diacylglycerol kinase alpha (DGKA)

  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 86.7 kDa
  • Buffer composition: Tris-based buffer, 50% glycerol
Description: Recombinant Human Diacylglycerol kinase alpha(DGKA) expressed in Baculovirus

Dgka ORF Vector (Rat) (pORF)

ORF065982 1.0 ug DNA
EUR 506

DGKA ORF Vector (Human) (pORF)

ORF003071 1.0 ug DNA
EUR 95

Dgka ORF Vector (Mouse) (pORF)

ORF042956 1.0 ug DNA
EUR 506

Recombinant Diacylglycerol Kinase Alpha (DGKa)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88673
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Diacylglycerol Kinase Alpha expressed in: E.coli

Recombinant Diacylglycerol Kinase Alpha (DGKa)

  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51556
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.7kDa
  • Isoelectric Point: 8.6
Description: Recombinant Rat Diacylglycerol Kinase Alpha expressed in: E.coli

DGKA ELISA Kit (Mouse) (OKEH04965)

OKEH04965 96 Wells
EUR 779
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL

DGKA ELISA Kit (Human) (OKEH04966)

OKEH04966 96 Wells
EUR 779
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.315 ng/mL

DGKA ELISA Kit (Rat) (OKEH03740)

OKEH03740 96 Wells
EUR 779
Description: Description of target: Upon cell stimulation converts the second messenger diacylglycerol into phosphatidate, initiating the resynthesis of phosphatidylinositols and attenuating protein kinase C activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.317 ng/mL

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Biotin.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Cy3.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with FITC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with HRP.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with PE.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Biotin.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with Cy3.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with FITC.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with HRP.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with PE.

Rat Diacylglycerol Kinase Alpha (DGKa) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Diacylglycerol Kinase Alpha (DGKa) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

DGKA sgRNA CRISPR Lentivector set (Human)

K0596301 3 x 1.0 ug
EUR 339

Dgka sgRNA CRISPR Lentivector set (Rat)

K6955301 3 x 1.0 ug
EUR 339

Dgka sgRNA CRISPR Lentivector set (Mouse)

K4621601 3 x 1.0 ug
EUR 339

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (His305~Arg531)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC-Cy7.

Diacylglycerol Kinase Alpha (DGKa) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DGKa (Ala312~Glu557)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Diacylglycerol Kinase Alpha (DGKa). This antibody is labeled with APC-Cy7.

Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit

E02D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit

E02D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Diacylglycerol kinase Alpha (DGKA) ELISA kit

E02D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Dgka/ Diacylglycerol kinase alpha ELISA Kit

E0395Mo 1 Kit
EUR 632

Human Diacylglycerol kinase Alpha (DGKA) ELISA kit

E01D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diacylglycerol kinase Alpha (DGKA) ELISA kit

E01D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diacylglycerol kinase Alpha (DGKA) ELISA kit

E01D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dgka/ Diacylglycerol kinase alpha ELISA Kit

E0292Ra 1 Kit
EUR 646

Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit

E03D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit

E03D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Diacylglycerol kinase Alpha (DGKA) ELISA kit

E03D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit

E06D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit

E06D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Diacylglycerol kinase Alpha (DGKA) ELISA kit

E06D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DGKA/ Diacylglycerol kinase alpha ELISA Kit

E0687Hu 1 Kit
EUR 605

Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit

E04D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit

E04D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Diacylglycerol kinase Alpha (DGKA) ELISA kit

E04D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Diacylglycerol Kinase Alpha (DGKA) ELISA Kit

abx256685-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit

E09D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit

E09D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Diacylglycerol kinase Alpha (DGKA) ELISA kit

E09D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit

E08D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit

E08D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Diacylglycerol kinase Alpha (DGKA) ELISA kit

E08D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit

E07D0283-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit

E07D0283-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Diacylglycerol kinase Alpha (DGKA) ELISA kit

E07D0283-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Diacylglycerol kinase Alpha (DGKA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Diacylglycerol kinase alpha, DGKA ELISA KIT

ELI-07742h 96 Tests
EUR 824

Mouse Diacylglycerol kinase alpha, Dgka ELISA KIT

ELI-07743m 96 Tests
EUR 865

Porcine Diacylglycerol kinase alpha, DGKA ELISA KIT

ELI-07744p 96 Tests
EUR 928

Bovine Diacylglycerol kinase alpha, DGKA ELISA KIT

ELI-07746b 96 Tests
EUR 928

Cow Diacylglycerol Kinase Alpha (DGKA) ELISA Kit

abx521265-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Diacylglycerol Kinase Alpha (DGKA) ELISA Kit

abx521266-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Diacylglycerol Kinase Alpha (DGKA) ELISA Kit

abx521267-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Pig Diacylglycerol Kinase Alpha (DGKA) ELISA Kit

abx521268-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Diacylglycerol Kinase Alpha (DGKA) ELISA Kit

abx595725-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Rat Dgka(Diacylglycerol kinase alpha) ELISA Kit

ER0710 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P51556
  • Alias: Dgka/DAGK1/DAG kinase alpha/DAGK/DAGK1diacylglycerol kinase, alpha(80kD)/DGK-alphaEC kinase alpha/diacylglycerol kinase, alpha 80kDa/Diglyceride kinase alpha/MGC12821,
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

DGKA sgRNA CRISPR Lentivector (Human) (Target 1)

K0596302 1.0 ug DNA
EUR 154

DGKA sgRNA CRISPR Lentivector (Human) (Target 2)

K0596303 1.0 ug DNA
EUR 154

DGKA sgRNA CRISPR Lentivector (Human) (Target 3)

K0596304 1.0 ug DNA
EUR 154

Dgka sgRNA CRISPR Lentivector (Rat) (Target 1)

K6955302 1.0 ug DNA
EUR 154

Dgka sgRNA CRISPR Lentivector (Rat) (Target 2)

K6955303 1.0 ug DNA
EUR 154

Dgka sgRNA CRISPR Lentivector (Rat) (Target 3)

K6955304 1.0 ug DNA
EUR 154

Dgka sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4621602 1.0 ug DNA
EUR 154

Dgka sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4621603 1.0 ug DNA
EUR 154

Dgka sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4621604 1.0 ug DNA
EUR 154

DGKA Protein Vector (Mouse) (pPB-C-His)

PV171822 500 ng
EUR 1065

DGKA Protein Vector (Mouse) (pPB-N-His)

PV171823 500 ng
EUR 1065
Scroll to Top